ID: 1196970382

View in Genome Browser
Species Human (GRCh38)
Location X:121101348-121101370
Sequence GGTTACCTAGATATTTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196970374_1196970382 1 Left 1196970374 X:121101324-121101346 CCATCTTAAGACTTAGGGCCACC No data
Right 1196970382 X:121101348-121101370 GGTTACCTAGATATTTTGGGGGG No data
1196970371_1196970382 14 Left 1196970371 X:121101311-121101333 CCAAACTATATCACCATCTTAAG No data
Right 1196970382 X:121101348-121101370 GGTTACCTAGATATTTTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196970382 Original CRISPR GGTTACCTAGATATTTTGGG GGG Intergenic
No off target data available for this crispr