ID: 1196972378

View in Genome Browser
Species Human (GRCh38)
Location X:121123831-121123853
Sequence CGTGACATTATGAAAGTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196972378_1196972379 -8 Left 1196972378 X:121123831-121123853 CCTTTAACTTTCATAATGTCACG No data
Right 1196972379 X:121123846-121123868 ATGTCACGATGCAGCACAAAAGG No data
1196972378_1196972380 9 Left 1196972378 X:121123831-121123853 CCTTTAACTTTCATAATGTCACG No data
Right 1196972380 X:121123863-121123885 AAAAGGTCTCAGCAGAAGCCAGG No data
1196972378_1196972381 10 Left 1196972378 X:121123831-121123853 CCTTTAACTTTCATAATGTCACG No data
Right 1196972381 X:121123864-121123886 AAAGGTCTCAGCAGAAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196972378 Original CRISPR CGTGACATTATGAAAGTTAA AGG (reversed) Intergenic
No off target data available for this crispr