ID: 1196972462

View in Genome Browser
Species Human (GRCh38)
Location X:121124474-121124496
Sequence CTGTGTTTGTTGATGTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196972455_1196972462 21 Left 1196972455 X:121124430-121124452 CCCCCTTTTTGGTCCTTTGGTTA No data
Right 1196972462 X:121124474-121124496 CTGTGTTTGTTGATGTTTCCAGG No data
1196972457_1196972462 19 Left 1196972457 X:121124432-121124454 CCCTTTTTGGTCCTTTGGTTAGA No data
Right 1196972462 X:121124474-121124496 CTGTGTTTGTTGATGTTTCCAGG No data
1196972456_1196972462 20 Left 1196972456 X:121124431-121124453 CCCCTTTTTGGTCCTTTGGTTAG No data
Right 1196972462 X:121124474-121124496 CTGTGTTTGTTGATGTTTCCAGG No data
1196972460_1196972462 8 Left 1196972460 X:121124443-121124465 CCTTTGGTTAGAGACAGAAGGCC No data
Right 1196972462 X:121124474-121124496 CTGTGTTTGTTGATGTTTCCAGG No data
1196972458_1196972462 18 Left 1196972458 X:121124433-121124455 CCTTTTTGGTCCTTTGGTTAGAG No data
Right 1196972462 X:121124474-121124496 CTGTGTTTGTTGATGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196972462 Original CRISPR CTGTGTTTGTTGATGTTTCC AGG Intergenic
No off target data available for this crispr