ID: 1196973469

View in Genome Browser
Species Human (GRCh38)
Location X:121134227-121134249
Sequence AGGCCCTTTTGGAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196973465_1196973469 2 Left 1196973465 X:121134202-121134224 CCATGGAAAAAGGACCTAATAAA No data
Right 1196973469 X:121134227-121134249 AGGCCCTTTTGGAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196973469 Original CRISPR AGGCCCTTTTGGAAGAGTGA AGG Intergenic
No off target data available for this crispr