ID: 1196975804

View in Genome Browser
Species Human (GRCh38)
Location X:121156320-121156342
Sequence TTTGCAACTTTTGAGTTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196975802_1196975804 10 Left 1196975802 X:121156287-121156309 CCATCTCATCTTGCCTGCTTTAA No data
Right 1196975804 X:121156320-121156342 TTTGCAACTTTTGAGTTGATTGG No data
1196975801_1196975804 19 Left 1196975801 X:121156278-121156300 CCTGTAACACCATCTCATCTTGC No data
Right 1196975804 X:121156320-121156342 TTTGCAACTTTTGAGTTGATTGG No data
1196975803_1196975804 -3 Left 1196975803 X:121156300-121156322 CCTGCTTTAATGTCACATTGTTT No data
Right 1196975804 X:121156320-121156342 TTTGCAACTTTTGAGTTGATTGG No data
1196975800_1196975804 24 Left 1196975800 X:121156273-121156295 CCTTTCCTGTAACACCATCTCAT No data
Right 1196975804 X:121156320-121156342 TTTGCAACTTTTGAGTTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196975804 Original CRISPR TTTGCAACTTTTGAGTTGAT TGG Intergenic
No off target data available for this crispr