ID: 1196988269

View in Genome Browser
Species Human (GRCh38)
Location X:121298883-121298905
Sequence CCTACTATGTATTTGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196988260_1196988269 12 Left 1196988260 X:121298848-121298870 CCACCTAGAACCACCAGTAGTCC No data
Right 1196988269 X:121298883-121298905 CCTACTATGTATTTGGAAGAGGG No data
1196988265_1196988269 -9 Left 1196988265 X:121298869-121298891 CCAGGAAGCACGATCCTACTATG No data
Right 1196988269 X:121298883-121298905 CCTACTATGTATTTGGAAGAGGG No data
1196988264_1196988269 -1 Left 1196988264 X:121298861-121298883 CCAGTAGTCCAGGAAGCACGATC No data
Right 1196988269 X:121298883-121298905 CCTACTATGTATTTGGAAGAGGG No data
1196988261_1196988269 9 Left 1196988261 X:121298851-121298873 CCTAGAACCACCAGTAGTCCAGG No data
Right 1196988269 X:121298883-121298905 CCTACTATGTATTTGGAAGAGGG No data
1196988263_1196988269 2 Left 1196988263 X:121298858-121298880 CCACCAGTAGTCCAGGAAGCACG No data
Right 1196988269 X:121298883-121298905 CCTACTATGTATTTGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196988269 Original CRISPR CCTACTATGTATTTGGAAGA GGG Intergenic
No off target data available for this crispr