ID: 1196993630

View in Genome Browser
Species Human (GRCh38)
Location X:121356620-121356642
Sequence TGGCGATCAGCAGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196993630_1196993639 24 Left 1196993630 X:121356620-121356642 CCGTCCACCACTGCTGATCGCCA No data
Right 1196993639 X:121356667-121356689 TCACCCCTCCAGATCCCGCAGGG No data
1196993630_1196993638 23 Left 1196993630 X:121356620-121356642 CCGTCCACCACTGCTGATCGCCA No data
Right 1196993638 X:121356666-121356688 TTCACCCCTCCAGATCCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196993630 Original CRISPR TGGCGATCAGCAGTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr