ID: 1196999807

View in Genome Browser
Species Human (GRCh38)
Location X:121426615-121426637
Sequence CACTGTGAGAAGTGAGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196999807_1196999814 12 Left 1196999807 X:121426615-121426637 CCATATTCTCACTTCTCACAGTG No data
Right 1196999814 X:121426650-121426672 ATAAGCCTGTCCAGTCTGAAAGG No data
1196999807_1196999819 25 Left 1196999807 X:121426615-121426637 CCATATTCTCACTTCTCACAGTG No data
Right 1196999819 X:121426663-121426685 GTCTGAAAGGTGGAGGTTAGTGG No data
1196999807_1196999815 15 Left 1196999807 X:121426615-121426637 CCATATTCTCACTTCTCACAGTG No data
Right 1196999815 X:121426653-121426675 AGCCTGTCCAGTCTGAAAGGTGG No data
1196999807_1196999817 18 Left 1196999807 X:121426615-121426637 CCATATTCTCACTTCTCACAGTG No data
Right 1196999817 X:121426656-121426678 CTGTCCAGTCTGAAAGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196999807 Original CRISPR CACTGTGAGAAGTGAGAATA TGG (reversed) Intergenic
No off target data available for this crispr