ID: 1197000641

View in Genome Browser
Species Human (GRCh38)
Location X:121435118-121435140
Sequence CTCCAAAGGGACTCTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197000641_1197000650 21 Left 1197000641 X:121435118-121435140 CCAGAAACAGAGTCCCTTTGGAG No data
Right 1197000650 X:121435162-121435184 ACATTTAGTCCACCACCATCAGG No data
1197000641_1197000646 -6 Left 1197000641 X:121435118-121435140 CCAGAAACAGAGTCCCTTTGGAG No data
Right 1197000646 X:121435135-121435157 TTGGAGTCCTCCCACTTAAGGGG No data
1197000641_1197000644 -8 Left 1197000641 X:121435118-121435140 CCAGAAACAGAGTCCCTTTGGAG No data
Right 1197000644 X:121435133-121435155 CTTTGGAGTCCTCCCACTTAAGG No data
1197000641_1197000645 -7 Left 1197000641 X:121435118-121435140 CCAGAAACAGAGTCCCTTTGGAG No data
Right 1197000645 X:121435134-121435156 TTTGGAGTCCTCCCACTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197000641 Original CRISPR CTCCAAAGGGACTCTGTTTC TGG (reversed) Intergenic
No off target data available for this crispr