ID: 1197002290

View in Genome Browser
Species Human (GRCh38)
Location X:121452930-121452952
Sequence GATAGCTCATGGTCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197002283_1197002290 19 Left 1197002283 X:121452888-121452910 CCCTGTCATCTTCTGCAGATAAC No data
Right 1197002290 X:121452930-121452952 GATAGCTCATGGTCTGTTACTGG No data
1197002284_1197002290 18 Left 1197002284 X:121452889-121452911 CCTGTCATCTTCTGCAGATAACT 0: 21
1: 199
2: 184
3: 120
4: 249
Right 1197002290 X:121452930-121452952 GATAGCTCATGGTCTGTTACTGG No data
1197002285_1197002290 -8 Left 1197002285 X:121452915-121452937 CCTCCCCTTTTGAGAGATAGCTC No data
Right 1197002290 X:121452930-121452952 GATAGCTCATGGTCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197002290 Original CRISPR GATAGCTCATGGTCTGTTAC TGG Intergenic
No off target data available for this crispr