ID: 1197004791

View in Genome Browser
Species Human (GRCh38)
Location X:121482396-121482418
Sequence TTCTGTGTGTTCTCACATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197004787_1197004791 -2 Left 1197004787 X:121482375-121482397 CCATTCCTCATAAATAGTGCCTT No data
Right 1197004791 X:121482396-121482418 TTCTGTGTGTTCTCACATGGTGG No data
1197004783_1197004791 25 Left 1197004783 X:121482348-121482370 CCAGAAGATTCAGTGTCCAGTGA No data
Right 1197004791 X:121482396-121482418 TTCTGTGTGTTCTCACATGGTGG No data
1197004788_1197004791 -7 Left 1197004788 X:121482380-121482402 CCTCATAAATAGTGCCTTCTGTG No data
Right 1197004791 X:121482396-121482418 TTCTGTGTGTTCTCACATGGTGG No data
1197004786_1197004791 9 Left 1197004786 X:121482364-121482386 CCAGTGAGGGACCATTCCTCATA No data
Right 1197004791 X:121482396-121482418 TTCTGTGTGTTCTCACATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197004791 Original CRISPR TTCTGTGTGTTCTCACATGG TGG Intergenic
No off target data available for this crispr