ID: 1197008182

View in Genome Browser
Species Human (GRCh38)
Location X:121529375-121529397
Sequence ATTTTTCTACAGATGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197008182_1197008191 19 Left 1197008182 X:121529375-121529397 CCTGCCCCCATCTGTAGAAAAAT No data
Right 1197008191 X:121529417-121529439 CTCTGATGTCAAAAATATTGGGG No data
1197008182_1197008190 18 Left 1197008182 X:121529375-121529397 CCTGCCCCCATCTGTAGAAAAAT No data
Right 1197008190 X:121529416-121529438 TCTCTGATGTCAAAAATATTGGG No data
1197008182_1197008189 17 Left 1197008182 X:121529375-121529397 CCTGCCCCCATCTGTAGAAAAAT No data
Right 1197008189 X:121529415-121529437 ATCTCTGATGTCAAAAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197008182 Original CRISPR ATTTTTCTACAGATGGGGGC AGG (reversed) Intergenic
No off target data available for this crispr