ID: 1197011470

View in Genome Browser
Species Human (GRCh38)
Location X:121569926-121569948
Sequence CATGCCACGTGGCTGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197011470_1197011478 25 Left 1197011470 X:121569926-121569948 CCCAGCAGCAGCCACGTGGCATG No data
Right 1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG No data
1197011470_1197011474 2 Left 1197011470 X:121569926-121569948 CCCAGCAGCAGCCACGTGGCATG No data
Right 1197011474 X:121569951-121569973 GAGAGAATCTGTGCAATTCAAGG No data
1197011470_1197011476 6 Left 1197011470 X:121569926-121569948 CCCAGCAGCAGCCACGTGGCATG No data
Right 1197011476 X:121569955-121569977 GAATCTGTGCAATTCAAGGAGGG No data
1197011470_1197011475 5 Left 1197011470 X:121569926-121569948 CCCAGCAGCAGCCACGTGGCATG No data
Right 1197011475 X:121569954-121569976 AGAATCTGTGCAATTCAAGGAGG No data
1197011470_1197011477 24 Left 1197011470 X:121569926-121569948 CCCAGCAGCAGCCACGTGGCATG No data
Right 1197011477 X:121569973-121569995 GAGGGAAAGTACAATGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197011470 Original CRISPR CATGCCACGTGGCTGCTGCT GGG (reversed) Intergenic
No off target data available for this crispr