ID: 1197011473

View in Genome Browser
Species Human (GRCh38)
Location X:121569937-121569959
Sequence GATTCTCTCTCCATGCCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197011473_1197011478 14 Left 1197011473 X:121569937-121569959 CCACGTGGCATGGAGAGAGAATC No data
Right 1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG No data
1197011473_1197011477 13 Left 1197011473 X:121569937-121569959 CCACGTGGCATGGAGAGAGAATC No data
Right 1197011477 X:121569973-121569995 GAGGGAAAGTACAATGATTGTGG No data
1197011473_1197011475 -6 Left 1197011473 X:121569937-121569959 CCACGTGGCATGGAGAGAGAATC No data
Right 1197011475 X:121569954-121569976 AGAATCTGTGCAATTCAAGGAGG No data
1197011473_1197011476 -5 Left 1197011473 X:121569937-121569959 CCACGTGGCATGGAGAGAGAATC No data
Right 1197011476 X:121569955-121569977 GAATCTGTGCAATTCAAGGAGGG No data
1197011473_1197011479 26 Left 1197011473 X:121569937-121569959 CCACGTGGCATGGAGAGAGAATC No data
Right 1197011479 X:121569986-121570008 ATGATTGTGGGACTTTGCATTGG No data
1197011473_1197011474 -9 Left 1197011473 X:121569937-121569959 CCACGTGGCATGGAGAGAGAATC No data
Right 1197011474 X:121569951-121569973 GAGAGAATCTGTGCAATTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197011473 Original CRISPR GATTCTCTCTCCATGCCACG TGG (reversed) Intergenic
No off target data available for this crispr