ID: 1197011476

View in Genome Browser
Species Human (GRCh38)
Location X:121569955-121569977
Sequence GAATCTGTGCAATTCAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197011470_1197011476 6 Left 1197011470 X:121569926-121569948 CCCAGCAGCAGCCACGTGGCATG No data
Right 1197011476 X:121569955-121569977 GAATCTGTGCAATTCAAGGAGGG No data
1197011471_1197011476 5 Left 1197011471 X:121569927-121569949 CCAGCAGCAGCCACGTGGCATGG No data
Right 1197011476 X:121569955-121569977 GAATCTGTGCAATTCAAGGAGGG No data
1197011467_1197011476 13 Left 1197011467 X:121569919-121569941 CCCATTTCCCAGCAGCAGCCACG No data
Right 1197011476 X:121569955-121569977 GAATCTGTGCAATTCAAGGAGGG No data
1197011463_1197011476 23 Left 1197011463 X:121569909-121569931 CCATCCTTCCCCCATTTCCCAGC No data
Right 1197011476 X:121569955-121569977 GAATCTGTGCAATTCAAGGAGGG No data
1197011464_1197011476 19 Left 1197011464 X:121569913-121569935 CCTTCCCCCATTTCCCAGCAGCA No data
Right 1197011476 X:121569955-121569977 GAATCTGTGCAATTCAAGGAGGG No data
1197011465_1197011476 15 Left 1197011465 X:121569917-121569939 CCCCCATTTCCCAGCAGCAGCCA No data
Right 1197011476 X:121569955-121569977 GAATCTGTGCAATTCAAGGAGGG No data
1197011468_1197011476 12 Left 1197011468 X:121569920-121569942 CCATTTCCCAGCAGCAGCCACGT No data
Right 1197011476 X:121569955-121569977 GAATCTGTGCAATTCAAGGAGGG No data
1197011466_1197011476 14 Left 1197011466 X:121569918-121569940 CCCCATTTCCCAGCAGCAGCCAC No data
Right 1197011476 X:121569955-121569977 GAATCTGTGCAATTCAAGGAGGG No data
1197011473_1197011476 -5 Left 1197011473 X:121569937-121569959 CCACGTGGCATGGAGAGAGAATC No data
Right 1197011476 X:121569955-121569977 GAATCTGTGCAATTCAAGGAGGG No data
1197011462_1197011476 29 Left 1197011462 X:121569903-121569925 CCTGCACCATCCTTCCCCCATTT No data
Right 1197011476 X:121569955-121569977 GAATCTGTGCAATTCAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197011476 Original CRISPR GAATCTGTGCAATTCAAGGA GGG Intergenic
No off target data available for this crispr