ID: 1197011477

View in Genome Browser
Species Human (GRCh38)
Location X:121569973-121569995
Sequence GAGGGAAAGTACAATGATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197011470_1197011477 24 Left 1197011470 X:121569926-121569948 CCCAGCAGCAGCCACGTGGCATG No data
Right 1197011477 X:121569973-121569995 GAGGGAAAGTACAATGATTGTGG No data
1197011468_1197011477 30 Left 1197011468 X:121569920-121569942 CCATTTCCCAGCAGCAGCCACGT No data
Right 1197011477 X:121569973-121569995 GAGGGAAAGTACAATGATTGTGG No data
1197011471_1197011477 23 Left 1197011471 X:121569927-121569949 CCAGCAGCAGCCACGTGGCATGG No data
Right 1197011477 X:121569973-121569995 GAGGGAAAGTACAATGATTGTGG No data
1197011473_1197011477 13 Left 1197011473 X:121569937-121569959 CCACGTGGCATGGAGAGAGAATC No data
Right 1197011477 X:121569973-121569995 GAGGGAAAGTACAATGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197011477 Original CRISPR GAGGGAAAGTACAATGATTG TGG Intergenic
No off target data available for this crispr