ID: 1197011478

View in Genome Browser
Species Human (GRCh38)
Location X:121569974-121569996
Sequence AGGGAAAGTACAATGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197011471_1197011478 24 Left 1197011471 X:121569927-121569949 CCAGCAGCAGCCACGTGGCATGG No data
Right 1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG No data
1197011473_1197011478 14 Left 1197011473 X:121569937-121569959 CCACGTGGCATGGAGAGAGAATC No data
Right 1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG No data
1197011470_1197011478 25 Left 1197011470 X:121569926-121569948 CCCAGCAGCAGCCACGTGGCATG No data
Right 1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197011478 Original CRISPR AGGGAAAGTACAATGATTGT GGG Intergenic
No off target data available for this crispr