ID: 1197012664

View in Genome Browser
Species Human (GRCh38)
Location X:121586137-121586159
Sequence CTCAAGTTCTTTAGCTAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197012664_1197012666 -7 Left 1197012664 X:121586137-121586159 CCATTTTAGCTAAAGAACTTGAG No data
Right 1197012666 X:121586153-121586175 ACTTGAGCCTCCATGGATTGTGG No data
1197012664_1197012673 28 Left 1197012664 X:121586137-121586159 CCATTTTAGCTAAAGAACTTGAG No data
Right 1197012673 X:121586188-121586210 GTTCTGGAACAAATCCCACTTGG No data
1197012664_1197012671 12 Left 1197012664 X:121586137-121586159 CCATTTTAGCTAAAGAACTTGAG No data
Right 1197012671 X:121586172-121586194 GTGGTATCCTCAGAGGGTTCTGG No data
1197012664_1197012669 5 Left 1197012664 X:121586137-121586159 CCATTTTAGCTAAAGAACTTGAG No data
Right 1197012669 X:121586165-121586187 ATGGATTGTGGTATCCTCAGAGG No data
1197012664_1197012670 6 Left 1197012664 X:121586137-121586159 CCATTTTAGCTAAAGAACTTGAG No data
Right 1197012670 X:121586166-121586188 TGGATTGTGGTATCCTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197012664 Original CRISPR CTCAAGTTCTTTAGCTAAAA TGG (reversed) Intergenic
No off target data available for this crispr