ID: 1197014212

View in Genome Browser
Species Human (GRCh38)
Location X:121604551-121604573
Sequence GCACACTCGTTTGCACCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197014206_1197014212 17 Left 1197014206 X:121604511-121604533 CCAGGGTACCAGCTTGCAAGGGC No data
Right 1197014212 X:121604551-121604573 GCACACTCGTTTGCACCAACAGG No data
1197014210_1197014212 9 Left 1197014210 X:121604519-121604541 CCAGCTTGCAAGGGCTGGGTGGT No data
Right 1197014212 X:121604551-121604573 GCACACTCGTTTGCACCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197014212 Original CRISPR GCACACTCGTTTGCACCAAC AGG Intergenic
No off target data available for this crispr