ID: 1197025266

View in Genome Browser
Species Human (GRCh38)
Location X:121740290-121740312
Sequence CTGCATCTGGATTTGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197025260_1197025266 30 Left 1197025260 X:121740237-121740259 CCATATTATACCACTGAGTAGAG No data
Right 1197025266 X:121740290-121740312 CTGCATCTGGATTTGGAGACAGG No data
1197025263_1197025266 20 Left 1197025263 X:121740247-121740269 CCACTGAGTAGAGGGTTGATAAA No data
Right 1197025266 X:121740290-121740312 CTGCATCTGGATTTGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197025266 Original CRISPR CTGCATCTGGATTTGGAGAC AGG Intergenic
No off target data available for this crispr