ID: 1197025545

View in Genome Browser
Species Human (GRCh38)
Location X:121744585-121744607
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197025545_1197025550 19 Left 1197025545 X:121744585-121744607 CCCTGATTCTTGGGGGCTTCAGA No data
Right 1197025550 X:121744627-121744649 CATTGCCTCCCCTGGTTCTCAGG No data
1197025545_1197025549 11 Left 1197025545 X:121744585-121744607 CCCTGATTCTTGGGGGCTTCAGA No data
Right 1197025549 X:121744619-121744641 ACTTATATCATTGCCTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197025545 Original CRISPR TCTGAAGCCCCCAAGAATCA GGG (reversed) Intergenic
No off target data available for this crispr