ID: 1197044411

View in Genome Browser
Species Human (GRCh38)
Location X:121978294-121978316
Sequence AGTTACCTGCAGAATATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197044411_1197044418 25 Left 1197044411 X:121978294-121978316 CCTGCCATATTCTGCAGGTAACT No data
Right 1197044418 X:121978342-121978364 GCCTGTTACTGGGCTTTGGTAGG No data
1197044411_1197044415 14 Left 1197044411 X:121978294-121978316 CCTGCCATATTCTGCAGGTAACT No data
Right 1197044415 X:121978331-121978353 GACAACTCTTGGCCTGTTACTGG 0: 17
1: 171
2: 183
3: 131
4: 176
1197044411_1197044416 15 Left 1197044411 X:121978294-121978316 CCTGCCATATTCTGCAGGTAACT No data
Right 1197044416 X:121978332-121978354 ACAACTCTTGGCCTGTTACTGGG 0: 17
1: 184
2: 186
3: 148
4: 230
1197044411_1197044413 3 Left 1197044411 X:121978294-121978316 CCTGCCATATTCTGCAGGTAACT No data
Right 1197044413 X:121978320-121978342 CTCCTTTGAGAGACAACTCTTGG No data
1197044411_1197044417 21 Left 1197044411 X:121978294-121978316 CCTGCCATATTCTGCAGGTAACT No data
Right 1197044417 X:121978338-121978360 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197044411 Original CRISPR AGTTACCTGCAGAATATGGC AGG (reversed) Intergenic
No off target data available for this crispr