ID: 1197044421

View in Genome Browser
Species Human (GRCh38)
Location X:121978363-121978385
Sequence GGAAATGAATGTTCAACTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197044414_1197044421 18 Left 1197044414 X:121978322-121978344 CCTTTGAGAGACAACTCTTGGCC No data
Right 1197044421 X:121978363-121978385 GGAAATGAATGTTCAACTATGGG No data
1197044419_1197044421 -3 Left 1197044419 X:121978343-121978365 CCTGTTACTGGGCTTTGGTAGGA No data
Right 1197044421 X:121978363-121978385 GGAAATGAATGTTCAACTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197044421 Original CRISPR GGAAATGAATGTTCAACTAT GGG Intergenic
No off target data available for this crispr