ID: 1197050070

View in Genome Browser
Species Human (GRCh38)
Location X:122046966-122046988
Sequence ACCTGGCTTTGTAGTGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197050070_1197050073 -2 Left 1197050070 X:122046966-122046988 CCCTGTTCACTACAAAGCCAGGT No data
Right 1197050073 X:122046987-122047009 GTGCCTGACTTCTGCACTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197050070 Original CRISPR ACCTGGCTTTGTAGTGAACA GGG (reversed) Intergenic
No off target data available for this crispr