ID: 1197053258

View in Genome Browser
Species Human (GRCh38)
Location X:122086612-122086634
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197053255_1197053258 29 Left 1197053255 X:122086560-122086582 CCTATAATATAATGTACTAATTA No data
Right 1197053258 X:122086612-122086634 CATGAGCTCTAATAAGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197053258 Original CRISPR CATGAGCTCTAATAAGGCAG AGG Intergenic
No off target data available for this crispr