ID: 1197055484

View in Genome Browser
Species Human (GRCh38)
Location X:122113751-122113773
Sequence GCTGCAGCAAGCCCCACTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197055484_1197055493 6 Left 1197055484 X:122113751-122113773 CCTTGAGTGGGGCTTGCTGCAGC No data
Right 1197055493 X:122113780-122113802 TGCTGTGGGGGATGGGGGTGTGG No data
1197055484_1197055495 21 Left 1197055484 X:122113751-122113773 CCTTGAGTGGGGCTTGCTGCAGC No data
Right 1197055495 X:122113795-122113817 GGGTGTGGTTCACAGGTCAATGG No data
1197055484_1197055488 -6 Left 1197055484 X:122113751-122113773 CCTTGAGTGGGGCTTGCTGCAGC No data
Right 1197055488 X:122113768-122113790 TGCAGCTGCAGCTGCTGTGGGGG No data
1197055484_1197055492 1 Left 1197055484 X:122113751-122113773 CCTTGAGTGGGGCTTGCTGCAGC No data
Right 1197055492 X:122113775-122113797 GCAGCTGCTGTGGGGGATGGGGG No data
1197055484_1197055490 -1 Left 1197055484 X:122113751-122113773 CCTTGAGTGGGGCTTGCTGCAGC No data
Right 1197055490 X:122113773-122113795 CTGCAGCTGCTGTGGGGGATGGG No data
1197055484_1197055491 0 Left 1197055484 X:122113751-122113773 CCTTGAGTGGGGCTTGCTGCAGC No data
Right 1197055491 X:122113774-122113796 TGCAGCTGCTGTGGGGGATGGGG No data
1197055484_1197055487 -7 Left 1197055484 X:122113751-122113773 CCTTGAGTGGGGCTTGCTGCAGC No data
Right 1197055487 X:122113767-122113789 CTGCAGCTGCAGCTGCTGTGGGG No data
1197055484_1197055485 -9 Left 1197055484 X:122113751-122113773 CCTTGAGTGGGGCTTGCTGCAGC No data
Right 1197055485 X:122113765-122113787 TGCTGCAGCTGCAGCTGCTGTGG No data
1197055484_1197055494 14 Left 1197055484 X:122113751-122113773 CCTTGAGTGGGGCTTGCTGCAGC No data
Right 1197055494 X:122113788-122113810 GGGATGGGGGTGTGGTTCACAGG No data
1197055484_1197055489 -2 Left 1197055484 X:122113751-122113773 CCTTGAGTGGGGCTTGCTGCAGC No data
Right 1197055489 X:122113772-122113794 GCTGCAGCTGCTGTGGGGGATGG No data
1197055484_1197055486 -8 Left 1197055484 X:122113751-122113773 CCTTGAGTGGGGCTTGCTGCAGC No data
Right 1197055486 X:122113766-122113788 GCTGCAGCTGCAGCTGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197055484 Original CRISPR GCTGCAGCAAGCCCCACTCA AGG (reversed) Intergenic