ID: 1197055814

View in Genome Browser
Species Human (GRCh38)
Location X:122117023-122117045
Sequence CTACATAAGCAGTATGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197055812_1197055814 19 Left 1197055812 X:122116981-122117003 CCACTCAAGACATTTTATTCAAC No data
Right 1197055814 X:122117023-122117045 CTACATAAGCAGTATGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197055814 Original CRISPR CTACATAAGCAGTATGAGCT TGG Intergenic
No off target data available for this crispr