ID: 1197057165

View in Genome Browser
Species Human (GRCh38)
Location X:122135173-122135195
Sequence CTCTCCACCATTAGAGGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197057157_1197057165 24 Left 1197057157 X:122135126-122135148 CCCAAGGGTGAGGTTGGAGTGAA No data
Right 1197057165 X:122135173-122135195 CTCTCCACCATTAGAGGGGGGGG No data
1197057156_1197057165 25 Left 1197057156 X:122135125-122135147 CCCCAAGGGTGAGGTTGGAGTGA No data
Right 1197057165 X:122135173-122135195 CTCTCCACCATTAGAGGGGGGGG No data
1197057158_1197057165 23 Left 1197057158 X:122135127-122135149 CCAAGGGTGAGGTTGGAGTGAAA No data
Right 1197057165 X:122135173-122135195 CTCTCCACCATTAGAGGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197057165 Original CRISPR CTCTCCACCATTAGAGGGGG GGG Intergenic
No off target data available for this crispr