ID: 1197057500

View in Genome Browser
Species Human (GRCh38)
Location X:122138504-122138526
Sequence CAGAACAAATTGATGAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197057498_1197057500 21 Left 1197057498 X:122138460-122138482 CCACATAGTTTTATATATATAAT No data
Right 1197057500 X:122138504-122138526 CAGAACAAATTGATGAAGTCTGG No data
1197057497_1197057500 29 Left 1197057497 X:122138452-122138474 CCTTTAATCCACATAGTTTTATA No data
Right 1197057500 X:122138504-122138526 CAGAACAAATTGATGAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197057500 Original CRISPR CAGAACAAATTGATGAAGTC TGG Intergenic
No off target data available for this crispr