ID: 1197069147

View in Genome Browser
Species Human (GRCh38)
Location X:122272579-122272601
Sequence AGAGGTATGCTGCAAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197069147_1197069151 1 Left 1197069147 X:122272579-122272601 CCTCCCACTTGCAGCATACCTCT No data
Right 1197069151 X:122272603-122272625 TCTGCTTATTTGTATAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197069147 Original CRISPR AGAGGTATGCTGCAAGTGGG AGG (reversed) Intergenic
No off target data available for this crispr