ID: 1197072610

View in Genome Browser
Species Human (GRCh38)
Location X:122317998-122318020
Sequence CAGAGATCACAGAAGGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 370}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197072610_1197072620 24 Left 1197072610 X:122317998-122318020 CCACCAGCCTTCTGTGATCTCTG 0: 1
1: 0
2: 4
3: 31
4: 370
Right 1197072620 X:122318045-122318067 AGACAGAGCTTGCTTAGGGGTGG 0: 1
1: 0
2: 3
3: 10
4: 150
1197072610_1197072619 21 Left 1197072610 X:122317998-122318020 CCACCAGCCTTCTGTGATCTCTG 0: 1
1: 0
2: 4
3: 31
4: 370
Right 1197072619 X:122318042-122318064 AAGAGACAGAGCTTGCTTAGGGG 0: 1
1: 1
2: 3
3: 43
4: 335
1197072610_1197072618 20 Left 1197072610 X:122317998-122318020 CCACCAGCCTTCTGTGATCTCTG 0: 1
1: 0
2: 4
3: 31
4: 370
Right 1197072618 X:122318041-122318063 CAAGAGACAGAGCTTGCTTAGGG 0: 1
1: 0
2: 1
3: 29
4: 255
1197072610_1197072617 19 Left 1197072610 X:122317998-122318020 CCACCAGCCTTCTGTGATCTCTG 0: 1
1: 0
2: 4
3: 31
4: 370
Right 1197072617 X:122318040-122318062 ACAAGAGACAGAGCTTGCTTAGG 0: 1
1: 1
2: 1
3: 14
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197072610 Original CRISPR CAGAGATCACAGAAGGCTGG TGG (reversed) Intergenic
900767763 1:4516730-4516752 CAGACAGCACAGGAGGCTCGCGG - Intergenic
900803413 1:4751686-4751708 CAAAGAGCACAGAGGCCTGGTGG + Intronic
901589720 1:10330896-10330918 CGGAGATCACATAACGTTGGGGG + Intronic
902236385 1:15060197-15060219 CGGAGATGACAGAGGGCTGCCGG - Exonic
903784068 1:25845536-25845558 AAGAGACCACACATGGCTGGGGG - Intronic
903891833 1:26574906-26574928 CAGAGTTCACAGGAGGCCAGTGG + Intronic
903956111 1:27027216-27027238 CAGAGATGGCAGTAAGCTGGAGG - Intergenic
904299338 1:29543990-29544012 CACCCATCACAGAAGGCTGTGGG + Intergenic
904899576 1:33846405-33846427 CAGAGGTCAGCAAAGGCTGGTGG + Intronic
905456351 1:38090706-38090728 CAGTGAACACAGAAGGGTGAAGG + Intergenic
906037995 1:42764927-42764949 TAGAGAGTAAAGAAGGCTGGGGG - Intronic
906177395 1:43786364-43786386 CACAGAGCACAGAAAGCAGGAGG - Intronic
907241460 1:53083563-53083585 CAGAGAAAACGGAAGACTGGAGG - Intronic
907762820 1:57378121-57378143 CAGAGCTCAGAGCAGGATGGAGG + Intronic
907787411 1:57626307-57626329 CACAGAACACAGCAGGCTAGAGG - Intronic
909496345 1:76283099-76283121 CAGAGGTCACTGAGGGATGGGGG - Intronic
910033937 1:82767302-82767324 CAGAGATAGCAGAGGGCTAGGGG + Intergenic
910498974 1:87866985-87867007 CATAGATCACAGAAGCTTTGGGG - Intergenic
911701981 1:100964088-100964110 CAGAGAGATCAGAAGGCTAGAGG + Intronic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
913082350 1:115400299-115400321 AAGAGATCCCTGTAGGCTGGAGG - Intergenic
913450453 1:118989260-118989282 TAGAGATCGCAAAAGGCAGGGGG - Intronic
914939237 1:152007430-152007452 CAGAGATCAAAGAAGGAGGCTGG - Intergenic
915670184 1:157482529-157482551 CAGAGATGTCAGAGGACTGGTGG - Intergenic
916642100 1:166741262-166741284 CAGAAAACACAGCAGGTTGGTGG + Intergenic
917137268 1:171799743-171799765 CAGCCATGACAGAAGACTGGAGG - Intronic
917180450 1:172290936-172290958 GTGATATCACAGAAGCCTGGAGG + Intronic
917369185 1:174270424-174270446 CAGAGATTACAAAAGGTAGGAGG + Intronic
918049475 1:180961823-180961845 CAGACTTCAGAGAATGCTGGGGG - Intergenic
918131737 1:181635411-181635433 GAAAGATGACAGAAGGCTGTGGG - Intronic
919841128 1:201610170-201610192 CACAAATCACAGGGGGCTGGAGG - Intergenic
920823594 1:209403749-209403771 CAGAGAACACAGAACACTCGAGG + Intergenic
920895548 1:210045565-210045587 CAGAGATAAGAAATGGCTGGAGG - Intronic
921022371 1:211247804-211247826 CAGATCTCACAGAAGGCAGGGGG + Intergenic
921200502 1:212800766-212800788 CACAGATCACAGAAGTCAGTAGG - Intronic
922542357 1:226428941-226428963 GAGAGATCAAAGAGTGCTGGAGG - Intergenic
922565323 1:226597819-226597841 CAGAGATCACAGGAGGAAGTGGG + Intronic
922663032 1:227446962-227446984 AAGAGCAAACAGAAGGCTGGGGG - Intergenic
922683742 1:227622812-227622834 AAGAGATGACTGATGGCTGGGGG - Intronic
922698494 1:227744051-227744073 CAGAGATGACATAAGGCTGATGG - Intronic
922751630 1:228072861-228072883 CAGGCATCACACCAGGCTGGTGG - Intergenic
923516806 1:234704514-234704536 CTGCGCTCACAGAGGGCTGGAGG + Intergenic
924636409 1:245791784-245791806 CAGAAATCAGAGAAGGCAAGAGG - Intronic
1063391078 10:5650187-5650209 CAGTGCTCAGAGTAGGCTGGTGG - Intronic
1063670425 10:8095570-8095592 CGGAGATGACTGAAGGATGGTGG + Intergenic
1064246498 10:13671766-13671788 CAGAGACCAGAAAAGGCTGGGGG + Intronic
1066440952 10:35437967-35437989 CAGCGATCAGAGTAGGCTGTGGG - Intronic
1067026851 10:42849931-42849953 TAGAGAGGAGAGAAGGCTGGGGG + Intergenic
1067106833 10:43372143-43372165 GAGAGACCAGTGAAGGCTGGGGG + Intronic
1069862555 10:71480714-71480736 CTGAGTGCAGAGAAGGCTGGAGG + Intronic
1069943325 10:71969995-71970017 AAGAGATGACAGAATGCTGCTGG + Intronic
1070307452 10:75248131-75248153 CAGAGACCACACCAGGCTGTCGG - Intergenic
1070668815 10:78363780-78363802 CAGAGATCCGAGCAGGATGGAGG + Intergenic
1071129195 10:82371782-82371804 CAGAGATCACACAAGGAAAGAGG + Intronic
1071513469 10:86281921-86281943 CAGACCTTACAGAAGGCAGGAGG - Intronic
1071911561 10:90240547-90240569 TAGAGATTACCAAAGGCTGGAGG + Intergenic
1074492517 10:113951834-113951856 GAGTGATCACAGGAGCCTGGTGG + Intergenic
1078491218 11:11770681-11770703 AAGAGATGACAGAAGTCTGATGG + Intergenic
1078626355 11:12962379-12962401 AAGAGAAGACAGAAGGCAGGAGG + Intergenic
1079098014 11:17523322-17523344 CAGAGAGCACAGAAGGCCCCAGG + Intronic
1079404647 11:20133886-20133908 CAGCCATCACAGCAGACTGGGGG - Intergenic
1080686880 11:34523354-34523376 CAGAGATTACAGATGGCTTTAGG + Intergenic
1081538311 11:44011728-44011750 CAGAGCTCACATATGGGTGGTGG + Intergenic
1081590651 11:44420748-44420770 AAGAAATCACAGAAGGCTCTGGG - Intergenic
1083366175 11:62142682-62142704 CAGAGTCCACAGAAGGCAGATGG - Intronic
1083488557 11:62998640-62998662 GGGAGAGCACAGAAAGCTGGGGG - Intronic
1084004447 11:66315617-66315639 CAGGGATCACAGGAGGCTGGTGG + Exonic
1084407781 11:68987124-68987146 CAGAGTTCACACAGGGCTAGAGG - Intergenic
1085290580 11:75396369-75396391 GAGAGATAACAGATGGATGGGGG + Intergenic
1087195811 11:95303292-95303314 CAGTGAGCACAGAAGACAGGAGG + Intergenic
1088535128 11:110852235-110852257 GAGAGAGCACAGAAGGATGAAGG + Intergenic
1088538382 11:110886228-110886250 CAATGGTCACAGAAGGGTGGAGG - Intergenic
1089036089 11:115393412-115393434 CAGATTTCACAGAAGACTGAAGG + Intronic
1089663525 11:120001570-120001592 CAGAGAGCACACAGGGCAGGTGG - Intergenic
1091362958 11:134992708-134992730 CAGAGATCAACAGAGGCTGGAGG + Intergenic
1091382851 12:73884-73906 TACAGATCACAGAGGGATGGTGG - Intronic
1091602772 12:1928078-1928100 CAGAGGCCACAGCAGCCTGGAGG + Intergenic
1091964539 12:4726893-4726915 CAGTGAACATTGAAGGCTGGGGG + Intronic
1093372542 12:18381997-18382019 CACAAATCCCAGAAGGCTGGAGG - Intronic
1093815738 12:23544247-23544269 AAGGGGTCACATAAGGCTGGAGG - Intronic
1094800376 12:34026260-34026282 CAGAAATCCCAGAAGGATGTAGG - Exonic
1095113165 12:38320558-38320580 CAGAAATCCCAGAAGGATGTAGG - Exonic
1095746307 12:45662579-45662601 CTCAGATCACAGCAGGCTAGTGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096790975 12:54044748-54044770 TAGAGATGTGAGAAGGCTGGGGG - Intronic
1097276076 12:57814395-57814417 CAGAGCTCACAGAAGCCAGAGGG - Intronic
1099234100 12:80061654-80061676 CAGAGATCACATAAGCTTGTGGG + Intergenic
1099596326 12:84671465-84671487 CAGAGACTACAGAAGGTAGGAGG + Intergenic
1099738308 12:86599615-86599637 CTGAGCTCACAGCAGGGTGGTGG + Intronic
1100293220 12:93236636-93236658 ATGAGATGACTGAAGGCTGGGGG - Intergenic
1100343922 12:93708596-93708618 GAGTGGTCAGAGAAGGCTGGTGG - Intronic
1101633528 12:106518468-106518490 CAGAGATCATAGAAGTCAGTAGG - Intronic
1102019051 12:109669043-109669065 AACAGCCCACAGAAGGCTGGTGG - Intergenic
1102095936 12:110241460-110241482 AAGAGAGCACAGAGGGATGGAGG - Intergenic
1102485300 12:113251518-113251540 CACAGACCACACATGGCTGGTGG - Intronic
1103080014 12:118016562-118016584 GAGAGTTCAGAGCAGGCTGGAGG + Intronic
1103836301 12:123823919-123823941 CACAGACCAGAGTAGGCTGGGGG - Intronic
1104294062 12:127495750-127495772 CAGAGTCCACTGAAGGCAGGTGG - Intergenic
1104466486 12:128994691-128994713 GAGAGAGCACAGTAGGCTGGGGG - Intergenic
1105558227 13:21465807-21465829 GAGTGTTTACAGAAGGCTGGAGG - Intergenic
1105998843 13:25699983-25700005 CAAAGGTCACAGAGAGCTGGAGG + Intronic
1106854934 13:33841213-33841235 CATGGACCCCAGAAGGCTGGAGG - Intronic
1107630095 13:42334174-42334196 CAGAGACCACAGAAGTCCAGCGG + Intergenic
1107879793 13:44822932-44822954 CGGAGTTCACAGAAGGCTTTCGG - Intergenic
1108670424 13:52681928-52681950 CAGGGATCATGGAAGGGTGGGGG - Intronic
1109665040 13:65523332-65523354 CAGAGATGACCAAAGGATGGAGG + Intergenic
1110426364 13:75371640-75371662 CAGAGAACACAGGAAGCTTGAGG - Intronic
1112048881 13:95625170-95625192 CATAGAACACAAAAAGCTGGAGG - Intronic
1112248563 13:97756780-97756802 AAGGGATCAGAGAAGGCTGCCGG - Intergenic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114657730 14:24326053-24326075 CGGAGAACAAAGAGGGCTGGGGG - Intronic
1114834631 14:26189036-26189058 CAGGGAGCAGAGAAGCCTGGAGG + Intergenic
1115070154 14:29312363-29312385 CAGAGACAATCGAAGGCTGGAGG + Intergenic
1115177591 14:30582068-30582090 CATAGCTGACAGAAGGCTGGAGG - Intronic
1115348410 14:32366884-32366906 CACAGCTCAGAGGAGGCTGGGGG + Intronic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1117730031 14:58713086-58713108 CAGACATCACAAAAGTCTTGAGG + Intergenic
1119116225 14:72024222-72024244 CAGTGAACACAGAAGGCTTGGGG + Intronic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1121436693 14:93925322-93925344 CACAAATCACAGAAGGCCTGGGG + Exonic
1123887868 15:24745535-24745557 AACTGACCACAGAAGGCTGGGGG - Intergenic
1124103164 15:26713894-26713916 CAGGGATCAGAGACGGCTGGTGG + Intronic
1124904507 15:33856213-33856235 CAGACCTCACAGAAAGCAGGTGG - Intronic
1127617531 15:60701780-60701802 CAGTGACCTCAGAAGTCTGGAGG + Intronic
1128612319 15:69084064-69084086 CAGGGAGGACATAAGGCTGGAGG + Intergenic
1129363949 15:75043065-75043087 CAGAGGCCACAGCAGGCAGGAGG - Intronic
1129411665 15:75353891-75353913 CAGAGACCCCAGGAGGCTGATGG + Intronic
1129779439 15:78260418-78260440 CAGAGAGCACAGATGGATGAAGG - Intergenic
1130684838 15:86027995-86028017 CAGAGATCACAGATACCTAGGGG - Intergenic
1131022144 15:89107877-89107899 CAGAGGACACAGACAGCTGGGGG - Intronic
1131234630 15:90684993-90685015 AAGAGATGATAGAAGACTGGGGG + Intergenic
1132238861 15:100242081-100242103 CAAAGAGCACAGGAGCCTGGGGG + Intronic
1132679635 16:1134422-1134444 CAGGGATCACGGAGGGCAGGGGG + Intergenic
1132688485 16:1172049-1172071 CAGAGTTCAGTGAAGGCTGCTGG - Intronic
1132855943 16:2044562-2044584 GAGAGACCTCAGAAGGCTGAGGG - Intronic
1132942661 16:2515648-2515670 CAAAGAACAGAGGAGGCTGGGGG - Intronic
1133873242 16:9709265-9709287 CTGAGAACCCAGAAGGCAGGAGG - Intergenic
1135706160 16:24676936-24676958 CAGAGAGAAAAGAAGGCTAGAGG - Intergenic
1137396503 16:48119212-48119234 CAGAGATCACGAGAGGATGGTGG - Intronic
1137794220 16:51201571-51201593 CAGATATCCCAGGAGGTTGGCGG - Intergenic
1137891691 16:52169778-52169800 TAGAGATCCAAGAAAGCTGGTGG - Intergenic
1138470672 16:57233343-57233365 CAGAGATGAGAGAAGACTGAGGG - Intronic
1139684632 16:68593408-68593430 CAGAGAGGGCAGAAGGCTGGCGG + Intergenic
1140039691 16:71397793-71397815 CAGAGACCACAGTTGGCTGTGGG + Intergenic
1141227975 16:82137302-82137324 CAGAGGTCAGAGAAGAGTGGTGG + Intergenic
1142882199 17:2890494-2890516 CAGTGCTCACAGACTGCTGGGGG + Intronic
1145905105 17:28511971-28511993 CACAGCCCACAGGAGGCTGGGGG + Intronic
1145989013 17:29066943-29066965 CAGAAATCATAGCAGGCGGGTGG - Intergenic
1146278893 17:31532317-31532339 CACACATCACAGAGGGCTGCTGG - Exonic
1146573720 17:33974133-33974155 CAGAGAGCACAGGAGGTTTGAGG - Intronic
1147377719 17:40032807-40032829 CAGAGTCCACAGAAGGGTGACGG - Intronic
1148125211 17:45233194-45233216 CCGAGAACAGGGAAGGCTGGTGG - Intronic
1148153872 17:45411709-45411731 CAGGAATCACAGAAGGCTGGAGG + Intronic
1148478678 17:47945959-47945981 CAGGGATCACAGAACTCTGGTGG - Exonic
1151233001 17:72698099-72698121 CACAGATCATAGCTGGCTGGAGG + Intronic
1151316432 17:73325350-73325372 CAGAAATCTAAGACGGCTGGGGG + Intergenic
1151666389 17:75547493-75547515 CAAAGAACCTAGAAGGCTGGAGG - Intronic
1151692017 17:75692405-75692427 CAGAGTTCACAGAAAGTTGCTGG - Intronic
1152827237 17:82474829-82474851 CTGAGATCACAGCAGGCTGTGGG - Intronic
1154488875 18:14903634-14903656 CAGAGATCAACAGAGGCTGGAGG - Intergenic
1155632715 18:27913061-27913083 CATAGCCCACAGAAGGCTGGTGG - Intergenic
1156486211 18:37467315-37467337 CAGAGATCCCAGAGGGCAAGAGG + Intronic
1157448224 18:47764332-47764354 CAGAGAAAACAGAATGCTGTTGG + Intergenic
1158194747 18:54872178-54872200 CAGAGAACACATAAAGCTGTCGG - Intronic
1158427674 18:57353589-57353611 CAGAAATCCCGGAAAGCTGGTGG - Intronic
1160128792 18:76205397-76205419 CAGAGCTCAGGGAAAGCTGGAGG + Intergenic
1160262542 18:77308349-77308371 AAGAGAACACAGAATGCTGTAGG + Intergenic
1162549676 19:11351542-11351564 CAGGGAAGACAGAAAGCTGGAGG + Intronic
1162792918 19:13072284-13072306 GGGAGCTCACAGAGGGCTGGGGG - Intronic
1163524532 19:17812626-17812648 CAGACAACTCAGAAGGTTGGGGG + Exonic
1164785188 19:30924953-30924975 CAGATATTACAGAGGCCTGGGGG + Intergenic
1165174884 19:33921493-33921515 CAGGCATCACACAAAGCTGGAGG - Intergenic
1165903815 19:39181411-39181433 CAAAGCTCTGAGAAGGCTGGAGG + Intronic
1166272719 19:41726692-41726714 CAGAGTTTCCACAAGGCTGGTGG + Intronic
1166706401 19:44910356-44910378 CAGATATCAGATAAGACTGGAGG - Intergenic
1167627575 19:50602775-50602797 CAGAGGGCACAGAGAGCTGGTGG - Intergenic
1168233553 19:55047970-55047992 CAGTGATCACAGCTGGCTTGGGG - Intronic
1168275681 19:55277073-55277095 CAGAGCTCACAGAAGGTTTGAGG - Intronic
925173441 2:1766788-1766810 CAGAGACCACAGGCTGCTGGAGG + Intergenic
925178032 2:1798516-1798538 CAGAGATGACACAGGGCTGCAGG - Intronic
925377344 2:3397369-3397391 CAGAGCTCACACAGGGCTGAAGG - Intronic
925377356 2:3397441-3397463 CAGAGCTCACACAGGGCTGTGGG - Intronic
925818563 2:7777192-7777214 CAGTGCTCACAAATGGCTGGTGG + Intergenic
925880215 2:8345939-8345961 CAGAGATTTCTGAAGGCAGGAGG - Intergenic
926888538 2:17619507-17619529 CTGAGACCTCAGAAGGCTCGGGG - Intronic
928606864 2:32951025-32951047 GAGAGATCACAGAAGACTGCTGG + Intronic
928608113 2:32962979-32963001 AAGTGATCACAGTAGGGTGGGGG - Intronic
929008883 2:37421913-37421935 CAGAGAACTCCCAAGGCTGGAGG + Intergenic
929057998 2:37895308-37895330 CAGAGACCAGAGAAAGCTTGTGG + Intergenic
929584757 2:43106633-43106655 GAAAGAGCACAGAAGGCAGGTGG - Intergenic
931617889 2:64179827-64179849 CAGAGATCAAACAAGGTTGTAGG + Intergenic
932261359 2:70330431-70330453 CTGAGCTCACAGAGTGCTGGAGG - Intergenic
932291439 2:70583401-70583423 CAGAGATCACTAAAGCCTAGGGG - Intergenic
933473438 2:82757654-82757676 AAGAGATCCCAGAAGGCCAGAGG + Intergenic
933485765 2:82921771-82921793 CAGACATCACAGGAGGATGTGGG - Intergenic
934528755 2:95071818-95071840 CAGAGACCACAGGAAGCGGGAGG - Intergenic
936588762 2:113782944-113782966 CTGAGATCATGAAAGGCTGGTGG - Intergenic
937222794 2:120351808-120351830 CAGACATCACGCAAGGCAGGAGG - Exonic
937241408 2:120464851-120464873 GAGAGCTCAAAGAAGGCTGGTGG - Intergenic
937355494 2:121195729-121195751 GGCAGATCACAGAGGGCTGGAGG + Intergenic
938307808 2:130266748-130266770 CACAGATGACAGAGGGCCGGGGG - Intergenic
938447529 2:131390093-131390115 CACAGATGACAGAGGGCCGGGGG + Intergenic
938924194 2:136024305-136024327 AAGAGATGGCAGAAGGCTGCAGG + Intergenic
940196746 2:151103625-151103647 CAGAGGTCACTGAAGGGTTGGGG - Intergenic
940239640 2:151549123-151549145 CCCAGTTCACAGAAGGCTAGAGG - Intronic
941001144 2:160204971-160204993 GAGAGAGCACATAAGGTTGGAGG + Intronic
941288966 2:163650735-163650757 CAAAGATCACATAAGTTTGGTGG - Intronic
943970319 2:194396417-194396439 CAGTGATCTCAGAAGCCTAGAGG + Intergenic
944523625 2:200596510-200596532 CAGAGATCACTGAGTGCCGGGGG - Intronic
944931152 2:204521010-204521032 CATAGAGCACAGAAGCATGGAGG + Intergenic
945171267 2:206998031-206998053 TAGAGATCCAGGAAGGCTGGTGG - Intergenic
946179099 2:217939502-217939524 CAAGGATCACAGAACGCTGTGGG + Intronic
946575030 2:221065831-221065853 CAGAGATCACAGACGGTTTAGGG - Intergenic
948080669 2:235202820-235202842 CAGGGCTTCCAGAAGGCTGGTGG - Intergenic
948575268 2:238945888-238945910 CAGAGAGCAAGGCAGGCTGGAGG - Intergenic
948687438 2:239677847-239677869 CTGAGAGCACAGAAGGCAGTGGG - Intergenic
1168833213 20:858848-858870 CAGAGAGCACAGAGGACTTGAGG + Intergenic
1169144829 20:3245263-3245285 CAGAGATCTAAAGAGGCTGGAGG - Intergenic
1169931626 20:10839300-10839322 CAGAAATCACAGTAGGGTGATGG - Intergenic
1170448642 20:16457847-16457869 CCAAGATCACAGAAAGATGGAGG + Intronic
1170508549 20:17054199-17054221 CAGAGCTCCCAGAGGGGTGGGGG - Intergenic
1170747711 20:19115512-19115534 CAGAGGTCCCAGAAGGGGGGAGG + Intergenic
1171410503 20:24943833-24943855 CAGAAATCACCAAAGGCAGGGGG + Intergenic
1173350147 20:42237430-42237452 CTGTGTTCACAGAAGTCTGGGGG + Intronic
1174454645 20:50640593-50640615 CCGAGATGACAGAGGGTTGGGGG - Intronic
1174543181 20:51305739-51305761 CAGAGATAACACAAAGGTGGGGG + Intergenic
1174611448 20:51801523-51801545 CGGAAATCAAAGATGGCTGGAGG + Intronic
1175247941 20:57592625-57592647 CAGGAATCACAGTGGGCTGGGGG + Intergenic
1175645483 20:60667238-60667260 CTGACATCAGAGAAGGATGGAGG - Intergenic
1176028430 20:62998197-62998219 CAGAGATCTCTCAGGGCTGGAGG + Intergenic
1176282331 20:64320875-64320897 TACAGATCACAGAGGGATGGTGG + Intergenic
1176296673 21:5076770-5076792 CAGAGACCACAGAAAGCTGAGGG + Intergenic
1176653463 21:9570408-9570430 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1179354884 21:40649929-40649951 TGGAGATTGCAGAAGGCTGGTGG + Intronic
1179732756 21:43376596-43376618 CAGAGCTCAGAGGAGGCAGGCGG - Intergenic
1179794887 21:43776808-43776830 CCGAGAACACTGAAGGCTGAAGG + Intergenic
1179860376 21:44185351-44185373 CAGAGACCACAGAAAGCTGAGGG - Intergenic
1180216333 21:46325371-46325393 CAGAGCTCCCAGGAGGGTGGAGG + Intronic
1180261796 21:46675258-46675280 CAGAGGGAACAGAAGGTTGGAGG - Intergenic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1180613480 22:17112466-17112488 CAGAGATCAAAGTAGCCTAGGGG - Exonic
1182101831 22:27662967-27662989 GAGAGATGCCAGAGGGCTGGAGG + Intergenic
1183319449 22:37156152-37156174 CAGAGGGAACAGGAGGCTGGAGG - Intronic
949396615 3:3621311-3621333 CAGAGGATAGAGAAGGCTGGAGG - Intergenic
949819030 3:8094957-8094979 GAGAAATCACTGAAAGCTGGTGG + Intergenic
949950188 3:9222473-9222495 CAGAAATCACCTAAAGCTGGTGG - Intronic
950394024 3:12719793-12719815 CTGAGGTCTTAGAAGGCTGGAGG + Intergenic
950878807 3:16304691-16304713 TAGAGATCACAGGAGGGTGAAGG + Exonic
954377311 3:50201977-50201999 CAGAGATTAGACAAGACTGGTGG + Intergenic
955748433 3:62163336-62163358 CAGAAATCCCATGAGGCTGGTGG - Intronic
956165226 3:66393244-66393266 CAGTGAGCACAAAAGGCAGGAGG + Intronic
956225596 3:66954253-66954275 AAGAGACCTTAGAAGGCTGGTGG - Intergenic
956268581 3:67425677-67425699 CAGAGACCCAGGAAGGCTGGTGG - Intronic
956457461 3:69436956-69436978 CAGAGTTTACAAGAGGCTGGGGG + Intronic
957791658 3:84949627-84949649 TAGAGAACAAAGAACGCTGGTGG + Intergenic
958884270 3:99708528-99708550 CAGAGATCAAAGAAGGGCGGAGG - Intronic
960550402 3:118969923-118969945 CAGACTTGACAGAAGGCTTGTGG - Intronic
961002360 3:123382732-123382754 TAGAGATGACCAAAGGCTGGGGG + Intronic
961046245 3:123710247-123710269 GAGAGATCACTGGTGGCTGGGGG - Intronic
961113269 3:124304010-124304032 CAAAGATGACAGAGGGCTTGGGG - Intronic
961564607 3:127754570-127754592 CAGAGAGGAGAGAGGGCTGGCGG + Intronic
961724413 3:128916801-128916823 AAGACAACACAGAAGGCTGGGGG + Intronic
962739988 3:138356627-138356649 CAGAGATGATAGAAGGAGGGTGG + Intronic
963764104 3:149315905-149315927 CTCAGATCTCAGAACGCTGGTGG - Intergenic
964524246 3:157600843-157600865 TAGAAATCACAGCAGGCTGAAGG - Exonic
964740338 3:159958622-159958644 CAGCGATTACAGAAAACTGGAGG + Intergenic
964879090 3:161403833-161403855 CAGACATCACAGAGGACCGGAGG - Intergenic
965643599 3:170857123-170857145 CAGATTTCACAGATTGCTGGTGG + Intronic
966781930 3:183591515-183591537 AAGAGCTCAAAGATGGCTGGAGG - Intergenic
967539999 3:190656293-190656315 CAGAGCTCAGAGAGGGCTGCAGG + Exonic
968602376 4:1516357-1516379 CACAGATCGCAAAAGGCCGGAGG - Intergenic
968843749 4:3027945-3027967 CAGAGATCCCAGAAGGACAGAGG + Exonic
969446345 4:7246878-7246900 CAGAGATGGCAGGAGGCTGTGGG - Intronic
969537855 4:7767699-7767721 CAGAGAGCACAGCAGGGGGGCGG + Intronic
969838826 4:9865667-9865689 AAGACATCACACATGGCTGGAGG + Intronic
970262908 4:14247785-14247807 CACAGTTCACAGGAAGCTGGTGG + Intergenic
970398328 4:15694082-15694104 CAGAGAACAAAGGAGACTGGGGG + Intronic
970716502 4:18932377-18932399 GAGATGTCACAGATGGCTGGTGG - Intergenic
971671274 4:29561064-29561086 AAGAGATCCCAGAAAGCTGGTGG - Intergenic
971799110 4:31265793-31265815 CATTGATCCCAGAATGCTGGAGG - Intergenic
972249142 4:37280943-37280965 CATACATCACAGCAAGCTGGAGG + Intronic
972795785 4:42417944-42417966 CAGTGATGAGAGAAGGCTGAAGG + Intronic
975833073 4:78390603-78390625 GAAAGATTACAGAAGGCTTGGGG - Intronic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976110152 4:81664239-81664261 AAGAGAGTACAGAAGGCTGAAGG + Intronic
976717138 4:88135192-88135214 CAGGGATGATAGAAGGGTGGAGG - Intronic
977097552 4:92765738-92765760 CAGAGAGCACTAAAGTCTGGTGG + Intronic
978496131 4:109360935-109360957 AGGAGATCAGAGAAAGCTGGAGG + Intergenic
978562357 4:110046539-110046561 CAGAGCTCACAGATGGCAGGGGG - Exonic
981002593 4:139842069-139842091 CAGAGTTCACTGCAGGCTGGGGG + Intronic
983387380 4:167082659-167082681 CAAAGATCAAGGAAGGCTGTAGG - Intronic
983813101 4:172088806-172088828 CAGAGATAACAGCAGGGTAGGGG + Intronic
984272750 4:177567661-177567683 CAGAGAAGAGAGATGGCTGGAGG + Intergenic
984559057 4:181246937-181246959 CAGAGAGCAAAGGAGGATGGAGG + Intergenic
985330836 4:188830860-188830882 CAGAGATCTCAAAAGCCAGGAGG - Intergenic
985780346 5:1867613-1867635 CAAACATCACAGCAGGCTGCAGG - Intergenic
985999614 5:3620246-3620268 CTGGGTTCACAGATGGCTGGCGG - Intergenic
988009388 5:25463207-25463229 CAGAGATCACATAAGGGTGTAGG + Intergenic
988513584 5:31886498-31886520 CACAGTTCTCAGAAGGGTGGAGG - Intronic
989191784 5:38677384-38677406 CGGAGATCCAAGAGGGCTGGGGG - Intergenic
990414056 5:55569161-55569183 CAGAGACCACGGCAGGCAGGCGG + Intergenic
990449690 5:55923184-55923206 GAGAGATCAGGGAAGCCTGGTGG + Intergenic
990609572 5:57443963-57443985 CAGAGATAAGAGCAGGCTGAGGG - Intergenic
990716828 5:58646703-58646725 GTGTGATCACAGAAAGCTGGAGG - Intronic
991642399 5:68768172-68768194 CAGATATCTCAGCAGCCTGGGGG - Intergenic
992202269 5:74396108-74396130 CTGAGAGCTCACAAGGCTGGAGG - Intergenic
993046697 5:82874364-82874386 CAAAGAATACAGAAGGCAGGTGG + Intergenic
995285788 5:110386842-110386864 CTGGGATCACAGAAGGCTTCTGG - Intronic
996208670 5:120776995-120777017 CAGAAATCCTAGAAGGCTGGAGG + Intergenic
997177610 5:131796328-131796350 CTGAGTTGAGAGAAGGCTGGAGG - Intronic
998185994 5:139980554-139980576 CAGATATCCTTGAAGGCTGGGGG + Intronic
999124851 5:149239488-149239510 CAGGGATCCCAGAAGCCTGAGGG - Intronic
999749670 5:154618205-154618227 TAGAAATCAGGGAAGGCTGGAGG - Intergenic
1000040437 5:157480971-157480993 TACAGATCACAGAGGGCTGGAGG - Exonic
1002508855 5:179699337-179699359 CAGAGGTCAAAGAAGGCTGTCGG - Intronic
1002538125 5:179889419-179889441 CACAGGTCACAGGAGGCAGGTGG + Intronic
1002716763 5:181232913-181232935 CAGCCAACACAGAATGCTGGGGG - Intronic
1003750953 6:9055379-9055401 CAGAAAGCAAAGAAGGCAGGTGG + Intergenic
1005893033 6:30155256-30155278 CACAGATGACAGAAGGAGGGCGG - Intronic
1006085201 6:31590111-31590133 CAGAGAGCACAGGATCCTGGGGG + Exonic
1006393693 6:33773465-33773487 CAGTGATGAGAAAAGGCTGGGGG - Intronic
1007285001 6:40741258-40741280 CAGAGTTCAGAGAAGGCTGGAGG - Intergenic
1007288999 6:40770123-40770145 GAGAGATTACAGCAGCCTGGGGG - Intergenic
1007359555 6:41345341-41345363 CACAGATCAGAGAGAGCTGGTGG - Intronic
1007714743 6:43849283-43849305 CAGGGTTTACAGAAGCCTGGGGG - Intergenic
1014153593 6:118086622-118086644 CAAAGAACAAAGGAGGCTGGAGG - Intronic
1015898083 6:138036214-138036236 CAGAGGGCACAGAGGCCTGGGGG + Intergenic
1016485017 6:144528327-144528349 AAAAGATCACACTAGGCTGGGGG - Intronic
1017525086 6:155235345-155235367 AGGAGTGCACAGAAGGCTGGGGG + Intronic
1017656473 6:156634082-156634104 GAGAGAACACGGAGGGCTGGTGG + Intergenic
1018708735 6:166482609-166482631 CTGCGATCACAGAAGGCTTCGGG + Intronic
1019144167 6:169966279-169966301 CAGAGCTCAGAGAAAGGTGGAGG - Intergenic
1019450615 7:1095845-1095867 CAGAAATCATACAGGGCTGGGGG + Intronic
1019634150 7:2066667-2066689 CAGACTTCCCAGAAGGCTGCGGG + Intronic
1020188006 7:5973709-5973731 CTGATTTCACAGAAGGGTGGAGG - Intronic
1020294912 7:6751060-6751082 CTGATTTCACAGAAGGGTGGAGG + Intergenic
1020632511 7:10656617-10656639 CAGAGAACTAAGAAGGCGGGTGG + Intergenic
1021014327 7:15513874-15513896 AAAATATCACAGAAGGGTGGTGG - Intronic
1021434636 7:20600308-20600330 CAGAAACCACAGGAGGGTGGGGG + Intergenic
1022456807 7:30564832-30564854 TAGAGACACCAGAAGGCTGGTGG + Intergenic
1022517484 7:30985113-30985135 CAGAGACCCCAGAGGGCGGGTGG - Intronic
1023583619 7:41706480-41706502 CTGAAATGACACAAGGCTGGGGG + Intergenic
1023842030 7:44103517-44103539 CAGAGGACCCAGAAGGCAGGTGG - Intergenic
1024243743 7:47454438-47454460 CAGAGATCCTGGGAGGCTGGTGG - Intronic
1024526773 7:50355846-50355868 CAGTGAGCAGAGCAGGCTGGAGG + Intronic
1024886657 7:54149746-54149768 CAGAGCAGACAGAAGCCTGGGGG + Intergenic
1025034777 7:55587326-55587348 CACAGATGAGAGAGGGCTGGGGG - Intergenic
1029853887 7:103493718-103493740 CAGAGAACCCAGAAGCCTAGGGG + Intronic
1030329083 7:108253854-108253876 CAGGGATGACAGAAGGTTGCTGG + Intronic
1032456929 7:132080225-132080247 AGGAGCTCACAGAAAGCTGGAGG - Intergenic
1033233076 7:139616795-139616817 GAGAGACCACTGCAGGCTGGAGG - Intronic
1034323376 7:150206114-150206136 CAGAGATCACAGAAATCATGAGG - Intergenic
1034769822 7:153763075-153763097 CAGAGATCACAGAAATCATGAGG + Intergenic
1035814612 8:2526125-2526147 CAGGGATCTCAGAAGGATGAAGG + Intergenic
1035939835 8:3886786-3886808 CAAAGATTACAGAAGGAAGGAGG + Intronic
1036392681 8:8338109-8338131 CAGAAATCAATGAAGGCTGGTGG - Intronic
1036766701 8:11553985-11554007 CAGAGTTCGCGGCAGGCTGGGGG - Intronic
1037933108 8:22895710-22895732 AAGAGAGAAAAGAAGGCTGGGGG - Intronic
1038611231 8:29061671-29061693 GGGAGATCATAGAAGGCTGTGGG - Intronic
1039250627 8:35660482-35660504 CAGAGAGCACAGAATGCTCCAGG - Intronic
1039451632 8:37679586-37679608 AAGCTCTCACAGAAGGCTGGAGG - Intergenic
1039839088 8:41280767-41280789 AGGAGACCACAGAAGGCTGCTGG + Intronic
1040537566 8:48323254-48323276 CAGAAGTCACAGAGGCCTGGAGG - Intergenic
1041683611 8:60620734-60620756 CAGGGAGGACAGCAGGCTGGGGG + Exonic
1041697418 8:60750728-60750750 CAGTGACCACACATGGCTGGTGG + Intronic
1042034185 8:64512599-64512621 CAGAAATCACTGAAGCCAGGAGG - Intergenic
1045513398 8:102833542-102833564 TAGATATCACAGAAGGAAGGAGG + Intronic
1046035407 8:108834453-108834475 CACAGATCACAAAAAGTTGGAGG - Intergenic
1046350621 8:113006341-113006363 CAGAGTTAAAAGAAGACTGGTGG + Intronic
1047818295 8:128489396-128489418 CAGAGAGGACAGTAGGCAGGAGG + Intergenic
1048603352 8:135942607-135942629 GAGAGCTCACAGCAGGCTGCTGG - Intergenic
1048950424 8:139492138-139492160 CAGTGCTCACAGAAGGCCAGCGG + Intergenic
1049308501 8:141920629-141920651 CAGGAATCACAGGAGTCTGGTGG - Intergenic
1050622721 9:7471488-7471510 CAGAAAGCACACAGGGCTGGAGG + Intergenic
1051383802 9:16485460-16485482 CAGAAATTCCAGAAGGCTTGTGG - Intronic
1051996026 9:23219368-23219390 CAGAGATGCCAAAAAGCTGGAGG + Intergenic
1052780449 9:32777327-32777349 GATAGATTACAGATGGCTGGTGG - Intergenic
1054835884 9:69673837-69673859 CAGAGCTCACAGTACGCTGAAGG + Intergenic
1054959122 9:70947630-70947652 CAGAGCTCAGAGAAGGTGGGGGG + Intronic
1054994111 9:71365151-71365173 CAGGGGTCACAGAATGGTGGAGG - Intronic
1055731063 9:79279679-79279701 CAGAGTTGGCAGAAGGCTAGGGG + Intergenic
1056601371 9:88049809-88049831 CAGTGATCACAAAAGGCAGGAGG + Intergenic
1056754693 9:89374324-89374346 CAGACCTAACAGAAAGCTGGCGG - Intronic
1057386511 9:94609894-94609916 GAGACCTCACAGGAGGCTGGGGG - Intronic
1057502853 9:95609629-95609651 CTGAGCTCACAAGAGGCTGGAGG + Intergenic
1059251826 9:112892647-112892669 CAGAGAACTCAGAAGCCTGGGGG - Intergenic
1059342301 9:113604482-113604504 CAGCCATCACGCAAGGCTGGAGG + Intergenic
1060992684 9:127857796-127857818 CAGAGGTCAGAGGAGGCAGGAGG + Intergenic
1062378740 9:136276654-136276676 CAGAGAATCCAGAAAGCTGGAGG + Intergenic
1062631192 9:137463915-137463937 CAGAGACCTCAGAAGGCTGGAGG - Intronic
1203631183 Un_KI270750v1:73855-73877 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1186407391 X:9316182-9316204 CAGAAATGACAGAAGCCAGGAGG + Intergenic
1186786253 X:12958357-12958379 CAGAGATCACAGTTGGCAAGTGG - Intergenic
1188380618 X:29487334-29487356 TAGAGATGAAAGAAGGTTGGGGG - Intronic
1188767404 X:34112441-34112463 CAGAGATAACGGAGGGGTGGGGG - Intergenic
1189064722 X:37795205-37795227 CAGAGATCTTGGAAGGTTGGTGG + Intronic
1189156355 X:38761212-38761234 CAGAGATAGCACAAGGTTGGTGG + Intergenic
1189845673 X:45134429-45134451 CAGAGTTCACCCAAGGTTGGTGG + Intergenic
1195687655 X:107600982-107601004 CAGGGGTGAGAGAAGGCTGGAGG + Exonic
1197072610 X:122317998-122318020 CAGAGATCACAGAAGGCTGGTGG - Intergenic
1197181510 X:123541878-123541900 CAGAAATCAGAGAAGTCTGGGGG - Intergenic
1198715616 X:139555259-139555281 CAGAGATCAGAGCAGGCTAAGGG + Intronic
1199664606 X:150086901-150086923 AAGTGATCACAGCAGGCTGGGGG - Intergenic
1199847478 X:151701480-151701502 CAGAAATCACAGAACTGTGGAGG - Exonic