ID: 1197078296

View in Genome Browser
Species Human (GRCh38)
Location X:122379061-122379083
Sequence AGGGAGAGCACAGTGACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197078296_1197078303 25 Left 1197078296 X:122379061-122379083 CCTTCAGTCACTGTGCTCTCCCT No data
Right 1197078303 X:122379109-122379131 TATGCTTCATTGCCACTGCTGGG No data
1197078296_1197078304 26 Left 1197078296 X:122379061-122379083 CCTTCAGTCACTGTGCTCTCCCT No data
Right 1197078304 X:122379110-122379132 ATGCTTCATTGCCACTGCTGGGG No data
1197078296_1197078302 24 Left 1197078296 X:122379061-122379083 CCTTCAGTCACTGTGCTCTCCCT No data
Right 1197078302 X:122379108-122379130 CTATGCTTCATTGCCACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197078296 Original CRISPR AGGGAGAGCACAGTGACTGA AGG (reversed) Intergenic
No off target data available for this crispr