ID: 1197078297

View in Genome Browser
Species Human (GRCh38)
Location X:122379080-122379102
Sequence TAATCTACATATGTAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197078297_1197078306 18 Left 1197078297 X:122379080-122379102 CCCTCCCCTACATATGTAGATTA No data
Right 1197078306 X:122379121-122379143 CCACTGCTGGGGTGCAAGAGAGG No data
1197078297_1197078308 20 Left 1197078297 X:122379080-122379102 CCCTCCCCTACATATGTAGATTA No data
Right 1197078308 X:122379123-122379145 ACTGCTGGGGTGCAAGAGAGGGG No data
1197078297_1197078302 5 Left 1197078297 X:122379080-122379102 CCCTCCCCTACATATGTAGATTA No data
Right 1197078302 X:122379108-122379130 CTATGCTTCATTGCCACTGCTGG No data
1197078297_1197078309 23 Left 1197078297 X:122379080-122379102 CCCTCCCCTACATATGTAGATTA No data
Right 1197078309 X:122379126-122379148 GCTGGGGTGCAAGAGAGGGGTGG No data
1197078297_1197078303 6 Left 1197078297 X:122379080-122379102 CCCTCCCCTACATATGTAGATTA No data
Right 1197078303 X:122379109-122379131 TATGCTTCATTGCCACTGCTGGG No data
1197078297_1197078304 7 Left 1197078297 X:122379080-122379102 CCCTCCCCTACATATGTAGATTA No data
Right 1197078304 X:122379110-122379132 ATGCTTCATTGCCACTGCTGGGG No data
1197078297_1197078307 19 Left 1197078297 X:122379080-122379102 CCCTCCCCTACATATGTAGATTA No data
Right 1197078307 X:122379122-122379144 CACTGCTGGGGTGCAAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197078297 Original CRISPR TAATCTACATATGTAGGGGA GGG (reversed) Intergenic
No off target data available for this crispr