ID: 1197078303

View in Genome Browser
Species Human (GRCh38)
Location X:122379109-122379131
Sequence TATGCTTCATTGCCACTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197078300_1197078303 1 Left 1197078300 X:122379085-122379107 CCCTACATATGTAGATTATCTCT No data
Right 1197078303 X:122379109-122379131 TATGCTTCATTGCCACTGCTGGG No data
1197078296_1197078303 25 Left 1197078296 X:122379061-122379083 CCTTCAGTCACTGTGCTCTCCCT No data
Right 1197078303 X:122379109-122379131 TATGCTTCATTGCCACTGCTGGG No data
1197078299_1197078303 2 Left 1197078299 X:122379084-122379106 CCCCTACATATGTAGATTATCTC No data
Right 1197078303 X:122379109-122379131 TATGCTTCATTGCCACTGCTGGG No data
1197078297_1197078303 6 Left 1197078297 X:122379080-122379102 CCCTCCCCTACATATGTAGATTA No data
Right 1197078303 X:122379109-122379131 TATGCTTCATTGCCACTGCTGGG No data
1197078301_1197078303 0 Left 1197078301 X:122379086-122379108 CCTACATATGTAGATTATCTCTC No data
Right 1197078303 X:122379109-122379131 TATGCTTCATTGCCACTGCTGGG No data
1197078298_1197078303 5 Left 1197078298 X:122379081-122379103 CCTCCCCTACATATGTAGATTAT No data
Right 1197078303 X:122379109-122379131 TATGCTTCATTGCCACTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197078303 Original CRISPR TATGCTTCATTGCCACTGCT GGG Intergenic
No off target data available for this crispr