ID: 1197078308

View in Genome Browser
Species Human (GRCh38)
Location X:122379123-122379145
Sequence ACTGCTGGGGTGCAAGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197078298_1197078308 19 Left 1197078298 X:122379081-122379103 CCTCCCCTACATATGTAGATTAT No data
Right 1197078308 X:122379123-122379145 ACTGCTGGGGTGCAAGAGAGGGG No data
1197078301_1197078308 14 Left 1197078301 X:122379086-122379108 CCTACATATGTAGATTATCTCTC No data
Right 1197078308 X:122379123-122379145 ACTGCTGGGGTGCAAGAGAGGGG No data
1197078297_1197078308 20 Left 1197078297 X:122379080-122379102 CCCTCCCCTACATATGTAGATTA No data
Right 1197078308 X:122379123-122379145 ACTGCTGGGGTGCAAGAGAGGGG No data
1197078300_1197078308 15 Left 1197078300 X:122379085-122379107 CCCTACATATGTAGATTATCTCT No data
Right 1197078308 X:122379123-122379145 ACTGCTGGGGTGCAAGAGAGGGG No data
1197078299_1197078308 16 Left 1197078299 X:122379084-122379106 CCCCTACATATGTAGATTATCTC No data
Right 1197078308 X:122379123-122379145 ACTGCTGGGGTGCAAGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197078308 Original CRISPR ACTGCTGGGGTGCAAGAGAG GGG Intergenic
No off target data available for this crispr