ID: 1197079951

View in Genome Browser
Species Human (GRCh38)
Location X:122400337-122400359
Sequence CTGCTACTCATTTGGAGTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197079947_1197079951 8 Left 1197079947 X:122400306-122400328 CCTTCTGGCACAAGGACTGTTGT No data
Right 1197079951 X:122400337-122400359 CTGCTACTCATTTGGAGTACGGG No data
1197079945_1197079951 18 Left 1197079945 X:122400296-122400318 CCATTTTTCTCCTTCTGGCACAA No data
Right 1197079951 X:122400337-122400359 CTGCTACTCATTTGGAGTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197079951 Original CRISPR CTGCTACTCATTTGGAGTAC GGG Intergenic
No off target data available for this crispr