ID: 1197084285

View in Genome Browser
Species Human (GRCh38)
Location X:122454160-122454182
Sequence TCAGGGGCATATCAAATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197084285_1197084289 -7 Left 1197084285 X:122454160-122454182 CCAGAGATTTGATATGCCCCTGA No data
Right 1197084289 X:122454176-122454198 CCCCTGAGGTAGGACAGTAAAGG 0: 89
1: 136
2: 135
3: 127
4: 191
1197084285_1197084293 18 Left 1197084285 X:122454160-122454182 CCAGAGATTTGATATGCCCCTGA No data
Right 1197084293 X:122454201-122454223 TTGCTGGCCTTGTCAGCTGAAGG No data
1197084285_1197084292 2 Left 1197084285 X:122454160-122454182 CCAGAGATTTGATATGCCCCTGA No data
Right 1197084292 X:122454185-122454207 TAGGACAGTAAAGGTATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197084285 Original CRISPR TCAGGGGCATATCAAATCTC TGG (reversed) Intergenic
No off target data available for this crispr