ID: 1197084292

View in Genome Browser
Species Human (GRCh38)
Location X:122454185-122454207
Sequence TAGGACAGTAAAGGTATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197084285_1197084292 2 Left 1197084285 X:122454160-122454182 CCAGAGATTTGATATGCCCCTGA No data
Right 1197084292 X:122454185-122454207 TAGGACAGTAAAGGTATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197084292 Original CRISPR TAGGACAGTAAAGGTATTGC TGG Intergenic
No off target data available for this crispr