ID: 1197088312

View in Genome Browser
Species Human (GRCh38)
Location X:122506428-122506450
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197088312_1197088314 7 Left 1197088312 X:122506428-122506450 CCTCTTTAGCTAGCATTTTAAAA No data
Right 1197088314 X:122506458-122506480 ATTTGGCTTTCTATTGAAGAAGG No data
1197088312_1197088317 14 Left 1197088312 X:122506428-122506450 CCTCTTTAGCTAGCATTTTAAAA No data
Right 1197088317 X:122506465-122506487 TTTCTATTGAAGAAGGTGGGAGG No data
1197088312_1197088316 11 Left 1197088312 X:122506428-122506450 CCTCTTTAGCTAGCATTTTAAAA No data
Right 1197088316 X:122506462-122506484 GGCTTTCTATTGAAGAAGGTGGG No data
1197088312_1197088313 -10 Left 1197088312 X:122506428-122506450 CCTCTTTAGCTAGCATTTTAAAA No data
Right 1197088313 X:122506441-122506463 CATTTTAAAATATCTTCATTTGG No data
1197088312_1197088315 10 Left 1197088312 X:122506428-122506450 CCTCTTTAGCTAGCATTTTAAAA No data
Right 1197088315 X:122506461-122506483 TGGCTTTCTATTGAAGAAGGTGG No data
1197088312_1197088318 15 Left 1197088312 X:122506428-122506450 CCTCTTTAGCTAGCATTTTAAAA No data
Right 1197088318 X:122506466-122506488 TTCTATTGAAGAAGGTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197088312 Original CRISPR TTTTAAAATGCTAGCTAAAG AGG (reversed) Intergenic
No off target data available for this crispr