ID: 1197088314

View in Genome Browser
Species Human (GRCh38)
Location X:122506458-122506480
Sequence ATTTGGCTTTCTATTGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197088311_1197088314 11 Left 1197088311 X:122506424-122506446 CCTGCCTCTTTAGCTAGCATTTT No data
Right 1197088314 X:122506458-122506480 ATTTGGCTTTCTATTGAAGAAGG No data
1197088312_1197088314 7 Left 1197088312 X:122506428-122506450 CCTCTTTAGCTAGCATTTTAAAA No data
Right 1197088314 X:122506458-122506480 ATTTGGCTTTCTATTGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197088314 Original CRISPR ATTTGGCTTTCTATTGAAGA AGG Intergenic
No off target data available for this crispr