ID: 1197088314 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:122506458-122506480 |
| Sequence | ATTTGGCTTTCTATTGAAGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1197088311_1197088314 | 11 | Left | 1197088311 | X:122506424-122506446 | CCTGCCTCTTTAGCTAGCATTTT | No data | ||
| Right | 1197088314 | X:122506458-122506480 | ATTTGGCTTTCTATTGAAGAAGG | No data | ||||
| 1197088312_1197088314 | 7 | Left | 1197088312 | X:122506428-122506450 | CCTCTTTAGCTAGCATTTTAAAA | No data | ||
| Right | 1197088314 | X:122506458-122506480 | ATTTGGCTTTCTATTGAAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1197088314 | Original CRISPR | ATTTGGCTTTCTATTGAAGA AGG | Intergenic | ||
| No off target data available for this crispr | |||||