ID: 1197088651

View in Genome Browser
Species Human (GRCh38)
Location X:122510134-122510156
Sequence ACTAGGCAGTGCCCCAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197088645_1197088651 24 Left 1197088645 X:122510087-122510109 CCACTATTCTGGGGTCTGGAGGA 0: 7
1: 40
2: 76
3: 52
4: 186
Right 1197088651 X:122510134-122510156 ACTAGGCAGTGCCCCAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197088651 Original CRISPR ACTAGGCAGTGCCCCAGTGT GGG Intergenic
No off target data available for this crispr