ID: 1197088947

View in Genome Browser
Species Human (GRCh38)
Location X:122513330-122513352
Sequence GCACCTCTTAGGTTTTAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197088947_1197088949 7 Left 1197088947 X:122513330-122513352 CCTTATTAAAACCTAAGAGGTGC No data
Right 1197088949 X:122513360-122513382 CTGTCTCGTGATAGCCTCCTAGG No data
1197088947_1197088951 19 Left 1197088947 X:122513330-122513352 CCTTATTAAAACCTAAGAGGTGC No data
Right 1197088951 X:122513372-122513394 AGCCTCCTAGGAAGATAAGGAGG No data
1197088947_1197088950 16 Left 1197088947 X:122513330-122513352 CCTTATTAAAACCTAAGAGGTGC No data
Right 1197088950 X:122513369-122513391 GATAGCCTCCTAGGAAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197088947 Original CRISPR GCACCTCTTAGGTTTTAATA AGG (reversed) Intergenic
No off target data available for this crispr