ID: 1197089905 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:122523831-122523853 |
| Sequence | CAGCCCTGGGAGAAGTGGTC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1197089905_1197089915 | 21 | Left | 1197089905 | X:122523831-122523853 | CCTGACCACTTCTCCCAGGGCTG | No data | ||
| Right | 1197089915 | X:122523875-122523897 | ATGACCAAAACCTACTCACATGG | No data | ||||
| 1197089905_1197089916 | 22 | Left | 1197089905 | X:122523831-122523853 | CCTGACCACTTCTCCCAGGGCTG | No data | ||
| Right | 1197089916 | X:122523876-122523898 | TGACCAAAACCTACTCACATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1197089905 | Original CRISPR | CAGCCCTGGGAGAAGTGGTC AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||