ID: 1197089905

View in Genome Browser
Species Human (GRCh38)
Location X:122523831-122523853
Sequence CAGCCCTGGGAGAAGTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197089905_1197089915 21 Left 1197089905 X:122523831-122523853 CCTGACCACTTCTCCCAGGGCTG No data
Right 1197089915 X:122523875-122523897 ATGACCAAAACCTACTCACATGG No data
1197089905_1197089916 22 Left 1197089905 X:122523831-122523853 CCTGACCACTTCTCCCAGGGCTG No data
Right 1197089916 X:122523876-122523898 TGACCAAAACCTACTCACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197089905 Original CRISPR CAGCCCTGGGAGAAGTGGTC AGG (reversed) Intergenic
No off target data available for this crispr