ID: 1197089916

View in Genome Browser
Species Human (GRCh38)
Location X:122523876-122523898
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197089910_1197089916 -3 Left 1197089910 X:122523856-122523878 CCAACCACCTGACACCACCATGA No data
Right 1197089916 X:122523876-122523898 TGACCAAAACCTACTCACATGGG No data
1197089909_1197089916 -2 Left 1197089909 X:122523855-122523877 CCCAACCACCTGACACCACCATG No data
Right 1197089916 X:122523876-122523898 TGACCAAAACCTACTCACATGGG No data
1197089911_1197089916 -7 Left 1197089911 X:122523860-122523882 CCACCTGACACCACCATGACCAA No data
Right 1197089916 X:122523876-122523898 TGACCAAAACCTACTCACATGGG No data
1197089907_1197089916 9 Left 1197089907 X:122523844-122523866 CCCAGGGCTGACCCAACCACCTG No data
Right 1197089916 X:122523876-122523898 TGACCAAAACCTACTCACATGGG No data
1197089908_1197089916 8 Left 1197089908 X:122523845-122523867 CCAGGGCTGACCCAACCACCTGA No data
Right 1197089916 X:122523876-122523898 TGACCAAAACCTACTCACATGGG No data
1197089905_1197089916 22 Left 1197089905 X:122523831-122523853 CCTGACCACTTCTCCCAGGGCTG No data
Right 1197089916 X:122523876-122523898 TGACCAAAACCTACTCACATGGG No data
1197089912_1197089916 -10 Left 1197089912 X:122523863-122523885 CCTGACACCACCATGACCAAAAC No data
Right 1197089916 X:122523876-122523898 TGACCAAAACCTACTCACATGGG No data
1197089906_1197089916 17 Left 1197089906 X:122523836-122523858 CCACTTCTCCCAGGGCTGACCCA No data
Right 1197089916 X:122523876-122523898 TGACCAAAACCTACTCACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197089916 Original CRISPR TGACCAAAACCTACTCACAT GGG Intergenic
No off target data available for this crispr