ID: 1197090960

View in Genome Browser
Species Human (GRCh38)
Location X:122536731-122536753
Sequence ACAGCTAAGGTAGAGCTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197090953_1197090960 27 Left 1197090953 X:122536681-122536703 CCTTTGAATTAAATGAAAACAGA No data
Right 1197090960 X:122536731-122536753 ACAGCTAAGGTAGAGCTTGGGGG No data
1197090952_1197090960 28 Left 1197090952 X:122536680-122536702 CCCTTTGAATTAAATGAAAACAG No data
Right 1197090960 X:122536731-122536753 ACAGCTAAGGTAGAGCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197090960 Original CRISPR ACAGCTAAGGTAGAGCTTGG GGG Intergenic
No off target data available for this crispr