ID: 1197094150

View in Genome Browser
Species Human (GRCh38)
Location X:122573875-122573897
Sequence GTACACCACATGGCAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197094143_1197094150 21 Left 1197094143 X:122573831-122573853 CCTCAGAGAGTTTTTATTCAAGG No data
Right 1197094150 X:122573875-122573897 GTACACCACATGGCAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197094150 Original CRISPR GTACACCACATGGCAAAAGC AGG Intergenic
No off target data available for this crispr