ID: 1197096411

View in Genome Browser
Species Human (GRCh38)
Location X:122601585-122601607
Sequence TATTGGTATCAGGGTAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197096411_1197096417 26 Left 1197096411 X:122601585-122601607 CCAGCATTACCCTGATACCAATA No data
Right 1197096417 X:122601634-122601656 AAACTACAGAAGGATATCACTGG No data
1197096411_1197096416 16 Left 1197096411 X:122601585-122601607 CCAGCATTACCCTGATACCAATA No data
Right 1197096416 X:122601624-122601646 CAAACAAAGAAAACTACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197096411 Original CRISPR TATTGGTATCAGGGTAATGC TGG (reversed) Intergenic