ID: 1197096412

View in Genome Browser
Species Human (GRCh38)
Location X:122601594-122601616
Sequence CTTATCTGGTATTGGTATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197096412_1197096416 7 Left 1197096412 X:122601594-122601616 CCCTGATACCAATACCAGATAAG No data
Right 1197096416 X:122601624-122601646 CAAACAAAGAAAACTACAGAAGG No data
1197096412_1197096417 17 Left 1197096412 X:122601594-122601616 CCCTGATACCAATACCAGATAAG No data
Right 1197096417 X:122601634-122601656 AAACTACAGAAGGATATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197096412 Original CRISPR CTTATCTGGTATTGGTATCA GGG (reversed) Intergenic