ID: 1197096413

View in Genome Browser
Species Human (GRCh38)
Location X:122601595-122601617
Sequence TCTTATCTGGTATTGGTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197096413_1197096416 6 Left 1197096413 X:122601595-122601617 CCTGATACCAATACCAGATAAGA No data
Right 1197096416 X:122601624-122601646 CAAACAAAGAAAACTACAGAAGG No data
1197096413_1197096417 16 Left 1197096413 X:122601595-122601617 CCTGATACCAATACCAGATAAGA No data
Right 1197096417 X:122601634-122601656 AAACTACAGAAGGATATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197096413 Original CRISPR TCTTATCTGGTATTGGTATC AGG (reversed) Intergenic
No off target data available for this crispr