ID: 1197096414

View in Genome Browser
Species Human (GRCh38)
Location X:122601602-122601624
Sequence GCTGTGTTCTTATCTGGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197096414_1197096417 9 Left 1197096414 X:122601602-122601624 CCAATACCAGATAAGAACACAGC No data
Right 1197096417 X:122601634-122601656 AAACTACAGAAGGATATCACTGG No data
1197096414_1197096416 -1 Left 1197096414 X:122601602-122601624 CCAATACCAGATAAGAACACAGC No data
Right 1197096416 X:122601624-122601646 CAAACAAAGAAAACTACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197096414 Original CRISPR GCTGTGTTCTTATCTGGTAT TGG (reversed) Intergenic
No off target data available for this crispr