ID: 1197096414 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:122601602-122601624 |
| Sequence | GCTGTGTTCTTATCTGGTAT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1197096414_1197096417 | 9 | Left | 1197096414 | X:122601602-122601624 | CCAATACCAGATAAGAACACAGC | No data | ||
| Right | 1197096417 | X:122601634-122601656 | AAACTACAGAAGGATATCACTGG | No data | ||||
| 1197096414_1197096416 | -1 | Left | 1197096414 | X:122601602-122601624 | CCAATACCAGATAAGAACACAGC | No data | ||
| Right | 1197096416 | X:122601624-122601646 | CAAACAAAGAAAACTACAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1197096414 | Original CRISPR | GCTGTGTTCTTATCTGGTAT TGG (reversed) | Intergenic | ||